BBa_M36801 1 BBa_M36801 lacUV5 Promoter (weak constitutive) 2014-04-29T11:00:00Z 2015-05-08T01:14:06Z http://www.biochem.wisc.edu/faculty/reznikoff/publications/139.pdf http://openwetware.org/images/1/1c/TheBacterialPromoter.pdf LacUV5 is a constitutive promoter mutated from of the lac promoter found in E. coli. The lac promoter is considered weak, it varies from the consensus sequence by 3 bases. On the other hand, the lacUV5 mutated promoter varies from the consensus sequence by only 1 base and is much stronger than the lac promoter. Even though lacUV5 is considered strong relative to other E. coli promoters, these are still weak when compared to T7 promoters. false false _848_ 0 22143 9 Not in stock false No significant design issues encountered. false Bradley Hammoor BBa_M36801_sequence 1 gcttccggctcgtataatgtgtggaattgtgagcggataacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z