BBa_M36802 1 BBa_M36802 alcR operator/promoter 2014-04-29T11:00:00Z 2015-05-08T01:14:06Z This concept comes from the 2011 iGEM ETH Zurich team. (http://2011.igem.org/Team:ETH_Zurich). It also comes from extensive research done by Beatrice Felenbok. The sequence is the highest affinity binding site for alcR-acetaldehyde complex. (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC364357/pdf/molcellb00027-0040.pdf) The alcR operator/promoter provides a binding site for the alcR protein-acetaldehyde complex. In Aspergillus nidulans, the alcR gene encodes a regulatory protein which activates the expression of the ethanol utilization (alc) pathway if the co-inducer acetaldehyde is present. Ethanol is converted to acetaldehyde by the alcohol dehydrogenase and further metabolized to acetate by the aldehyde dehydrogenase. Both genes alcA and aldA are regulated by AlcR. AlcR also regulates its own expression by autoactivation. The AlcR DNA binding domain contains a zinc bi-nuclear cluster, which can bind either to symmetric and asymmetric sites with same affinity. In contrast to other members of the Zn2Cys6, the DNA binding domain is stretch of 16 amino acid residues between the third and fourth cysteine. AlcR binds as a monomer, but 2 proteins can bind to inverted repeats in a noncooperative manner. Additional DNA sequences upstream of the zinc cluster were identified to be responsible for high-affinity binding, false false _848_ 0 22143 9 Not in stock false The mechanism by which the complex binds and inhibits/activates this region is currently unknown. false Bradley Hammoor BBa_M36802_sequence 1 gggctagcggaaatgcggggggcggccatgcggagccgcacgcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z