BBa_M36808 1 BBa_M36808 PoPS -> Cell Lysis 2013-12-17T12:00:00Z 2015-05-08T01:14:06Z The sequences for all three proteins were found from Part BBa_K124017 in the BioBricks registry. All Ribosome Binding Sites and the Terminator found from the biofab website in the data section. This actuator, upon receiving a Polymerase per Second (PoPS) signal, creates 3 proteins that induce cell lysis in E. Coli. Each protein is paired with a Ribosome Binding Site already included in the sequence. This part has been proven to have consistent success in cell lysis of E. Coli. The three proteins transcribed from the sequence are a Holin (lysis the cell by inserting itself in the plasma membrane and causing cell lysis after reaching a critical mass), an Endolysin (destabilizes the cell wall), and an Rz Protein (helps the holin enter the plasma membrane). The sequence is void of all repeats and palindromes greater than or equal to 10 bp thus allowing it to be synthesized with relative ease. To use this product one would simply have to pair this part with a sensor that would then send a PoPS signal and cause the cell to lyse. This actuator has been proven to cause lysis even at very low levels of activation. Despite this, it has also been shown to not cause lysis unless activated. false false _848_ 0 19315 9 Not in stock false The sequence was altered in a few places in order to avoid repeats and palindromes. Also, the sequence had to be edited further when the Ribosome Binding Sites(RBS) were added to avoid repeats. It's also important to note that the part utilizes one Bicistronic Design(BCD) and two Monocistronic Designs(MCD) for the RBS's. Three BCDs would have been used but all BCDs have significant overlapping sequences and only one could be used to avoid repeats. All RBS's were chosen for low to medium expression level and low variance. false Max Whitmeyer annotation2371730 1 Terminator range2371730 1 1402 1442 annotation2371729 1 Rz Protein range2371729 1 940 1401 annotation2371724 1 RBS 1 - BCD range2371724 1 1 85 annotation2371728 1 RBS 3 - MCD range2371728 1 910 939 annotation2371727 1 Endolysin range2371727 1 433 909 annotation2371725 1 Holin range2371725 1 86 403 annotation2371726 1 RBS 2 - MCD range2371726 1 404 432 BBa_M36808_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggactctttctgatgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtaggaatcaataatcttaatcatgcgccggaggttttctaatatggtagaaatcaacaatcaacgtaaggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgatgtcattgtaggcggagagctatttactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggatgcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattgatcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcctgattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtatgatcttaatcatgctgaggaaagtttctaatgatgagcagagtcaccgcgattatctccgctctggttatctgcatcatcgtctgcctgtcatgggctgttaatcattaccgtgataacgccattacctacaaagcccagcgcgacaaaaatgccagagaactgaagctggcgaacgcggcaattactgacatgcagatgcgtcagcgtgatgttgctgcgctcgatgcaaaatacacgaaggagttagctgatgctaaagctgaaaatgatgctctgcgtgatgatgttgccgctggtcgtcgtcggttgcacatcaaagcagtctgtcagtcagtgcgtgaagccaccaccgcctccggcgtggataatgcagcctccccccgactggcagacaccgctgaacgggattatttcaccctcagagagaggctgatcactatgcaaaaacaactggaaggaacccagaagtatattaatgagcagtgcagatagaaaaaaaaaccccgcccctgacagggcggggtttttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z