BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_M11082 1 BBa_M11082 ZntR:Zn(II)-responsive regulator of zntA (also MerR transcriptional regulator) 2009-04-17T11:00:00Z 2015-05-08T01:13:53Z JGI merR, coding sequence for mercury detecting transcriptional regulator false false _302_ 0 4568 302 Not in stock true To start the following mercury binding gene false Xianyu Meng annotation2002486 1 start range2002486 1 1 3 BBa_K190022 1 BBa_K190022 Zinc Promoter (ZntR regulated) with own RBS 2009-08-24T11:00:00Z 2015-05-08T01:11:15Z Strain: E.coli k.12 The pZntR from E.coli K.12 has a specific RBS site behind it in the genome. Here the RBS site is attachted to the promoter region. The RBS site might influence the activity of the promoter and will be tested in the same way as BBa_K190016. false false _306_ 0 4144 9 It's complicated false The short sequence did not contain any unwanted restriction sites. false Michael Verhoeven annotation2017704 1 -35 and -10 region range2017704 1 34 69 annotation2017703 1 RBS site range2017703 1 70 91 BBa_M36827 1 BBa_M36827 Zinc Sensor 2014-10-21T11:00:00Z 2015-05-08T01:14:06Z The genomic sequence comes from an E. Coli protein (ZntR) found in basic parts within the registry. This composite part contains a promoter and ribosome-binding-site, a gene for ZntR, a terminator, and a promoter for ZntA. In the absence of Zinc, the ZntR protein binds to the ZntA binding site. In the presence of zinc, ZntR undergoes a conformation, does not attach to the binding site, and allows for transcription of ZntA. Essentially, this part acts as a sensor for the presence of zinc. true false _848_ 0 24110 9 Discontinued false We had to enter silent mutations to change the DNA sequence without affecting the amino acid sequence because there were palindromes greater than 10 bp in every basic part. false Leah Chase component2428893 1 BBa_K190022 component2428900 1 BBa_K190016 component2428896 1 BBa_B0010 component2428895 1 BBa_M11082 annotation2428896 1 BBa_B0010 range2428896 1 520 599 annotation2428893 1 BBa_K190022 range2428893 1 1 91 annotation2428900 1 BBa_K190016 range2428900 1 608 676 annotation2428895 1 BBa_M11082 range2428895 1 98 511 BBa_K190016 1 BBa_K190016 Zinc Promoter (ZntR regulated) 2009-07-14T11:00:00Z 2015-05-08T01:11:15Z E.coli TOP10 Promoter sequence with recognition site for ZntR transcriptional regulator protein. false false _306_ 0 4144 9 It's complicated false None false Michael Verhoeven annotation2011503 1 -35 and -10 region range2011503 1 35 69 annotation2011504 1 Palindromic binding site for ZntR range2011504 1 32 53 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_M11082_sequence 1 atgtatcgcatcggccaaattgcaaaattagcgaatgttacaacagatactatccgtttttatgaaaaacaaggattgatggaacatgatagacggacagaaggtggctatcgtctgtatacagaacaagatttgcaaagattacgctttattcgttatgccaaagagttaggctttactctggatgctattactgagttactttcaattagagtcgatcctgcgcatcatacttgtgtagaatcaaaacatattgttgatgctaggctagcagaagttgaggctcgtctaaaagaaatggaaaagatgcgtgattctttaaaaatgttaagcaatgcttgctgtggaaccgctcatgaaagtacatattgttcaattctagaaatacttgaatctggagcgacaaagcaataa BBa_K190016_sequence 1 cgtccgctcgctgtatctctgataaaacttgactctggagtcgactccagagtgtatccttcggttaat BBa_M36827_sequence 1 cgtccgctcgctgtatctctgataaaacttgactctggagtcgactccagagtgtatccttcggttaatgagaaaaaacttaaccggaggatactagatgtatcgcatcggccaaattgcaaaattagcgaatgttacaacagatactatccgtttttatgaaaaacaaggattgatggaacatgatagacggacagaaggtggctatcgtctgtatacagaacaagatttgcaaagattacgctttattcgttatgccaaagagttaggctttactctggatgctattactgagttactttcaattagagtcgatcctgcgcatcatacttgtgtagaatcaaaacatattgttgatgctaggctagcagaagttgaggctcgtctaaaagaaatggaaaagatgcgtgattctttaaaaatgttaagcaatgcttgctgtggaaccgctcatgaaagtacatattgttcaattctagaaatacttgaatctggagcgacaaagcaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagcgtccgctcgctgtatctctgataaaacttgactctggagtcgactccagagtgtatccttcggttaat BBa_K190022_sequence 1 cgtccgctcgctgtatctctgataaaacttgactctggagtcgactccagagtgtatccttcggttaatgagaaaaaacttaaccggagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z