BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_M36828 1 BBa_M36828 Zinc Sensor 2014-10-21T11:00:00Z 2015-05-08T01:14:06Z The genomic sequence comes from an E. Coli protein (ZntR) found in basic parts within the registry. This composite part contains a promoter and ribosome-binding-site, a gene for ZntR, a terminator, and a promoter for ZntA. In the absence of Zinc, the ZntR protein binds to the ZntA binding site. In the presence of zinc, ZntR undergoes a conformation, does not attach to the binding site, and allows for transcription of ZntA. Essentially, this part acts as a sensor for the presence of zinc. false false _848_ 0 24110 9 Not in stock false We had to enter silent mutations to change the DNA sequence without affecting the amino acid sequence because there were palindromes greater than 10 bp in every basic part. false Leah Chase component2429097 1 BBa_J61101 component2429099 1 BBa_B0010 component2429098 1 BBa_M36919 component2429103 1 BBa_K190016 component2429096 1 BBa_J23108 annotation2429096 1 BBa_J23108 range2429096 1 1 35 annotation2429099 1 BBa_B0010 range2429099 1 462 541 annotation2429098 1 BBa_M36919 range2429098 1 48 461 annotation2429097 1 BBa_J61101 range2429097 1 36 47 annotation2429103 1 BBa_K190016 range2429103 1 542 610 BBa_M36919 1 BBa_M36919 ZntR:Zn(II)-responsive regulator of zntA (also MerR transcriptional regulator) 2014-10-21T11:00:00Z 2015-05-08T01:14:07Z Protein This part can act not only the responsive regulator of zntA(Zinc transportation) but also the MerR(Mercury resistance) transcriptional regulator. false false _848_ 0 24110 9 Not in stock false No. false Leah Chase BBa_J23108 1 BBa_J23108 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K190016 1 BBa_K190016 Zinc Promoter (ZntR regulated) 2009-07-14T11:00:00Z 2015-05-08T01:11:15Z E.coli TOP10 Promoter sequence with recognition site for ZntR transcriptional regulator protein. false false _306_ 0 4144 9 It's complicated false None false Michael Verhoeven annotation2011503 1 -35 and -10 region range2011503 1 35 69 annotation2011504 1 Palindromic binding site for ZntR range2011504 1 32 53 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J61101_sequence 1 aaagacaggacc BBa_M36828_sequence 1 ctgacagctagctcagtcctaggtataatgctagcaaagacaggaccatgtatagaatcggccagatcgcgaagttagccaatgtcaccacggacacgattcgtttctatgagaagcaaggtctgatggaacacgaccgccgtaccgagggcggttaccgtttgtacaccgagcaagatctgcagcgcctgcgtttcattcgctacgcgaaagaactgggctttaccctggatgcgatcaccgagctgctgagcatccgtgttgacccggcacaccatacttgtgtggagagcaagcacattgtggatgcgcgcctggctgaagttgaggcacgtttgaaagaaatggaaaaaatgcgtgacagcctgaagatgctgtctaacgcatgctgtggtacggcccatgagagcacctattgctccattctggaaatcctggagagcggtgcgacgaaacagtgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctccgtccgctcgctgtatctctgataaaacttgactctggagtcgactccagagtgtatccttcggttaat BBa_J23108_sequence 1 ctgacagctagctcagtcctaggtataatgctagc BBa_K190016_sequence 1 cgtccgctcgctgtatctctgataaaacttgactctggagtcgactccagagtgtatccttcggttaat BBa_M36919_sequence 1 atgtatagaatcggccagatcgcgaagttagccaatgtcaccacggacacgattcgtttctatgagaagcaaggtctgatggaacacgaccgccgtaccgagggcggttaccgtttgtacaccgagcaagatctgcagcgcctgcgtttcattcgctacgcgaaagaactgggctttaccctggatgcgatcaccgagctgctgagcatccgtgttgacccggcacaccatacttgtgtggagagcaagcacattgtggatgcgcgcctggctgaagttgaggcacgtttgaaagaaatggaaaaaatgcgtgacagcctgaagatgctgtctaacgcatgctgtggtacggcccatgagagcacctattgctccattctggaaatcctggagagcggtgcgacgaaacagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z