BBa_M36844 1 BBa_M36844 p14ARF enhancer and promoter 2015-10-24T11:00:00Z 2015-10-25T02:02:24Z Homo sapiens p14ARF enhancer and promoter sequences This sensor includes the p14ARF enhancer and promoter regions. Many oncogenes, including E2F1 and myc, are attracted to the p14ARF enhancer and bind to the promoter, initiating transcription of the p14aARF gene. p14ARF is an alternate reading frame protein that can activate p53, inducing apoptosis. This sensor allows for the detection of p14ARF expression by inserting the p14ARF promoter and enhancer into a S. cerevisiae sensor test rig (part BBa_M36093) or a mammalian sensor test rig (part BBa_M36097), both of which contain GFP coding sequences. Thus, cells transcribing the p14ARF enhancer and promoter sequence will be detectable through a Fluorescent Report Assay. false false _848_ 29117 29117 9 false This part requires insertion into a plasmid that expresses GFP or another fluorescent protein to allow for detection of transcription. false Jasmine Johnson, Katie Plummer, Matthew Ryan Frankel annotation2478402 1 p14ARF Promoter range2478402 1 407 566 annotation2478401 1 p14ARF Enhancer range2478401 1 1 406 BBa_M36844_sequence 1 caattgccctcctgttaagactttgtcttcctcagcactccgaaccaaaatgattctgtaaacaaaaattgttcacttttaggagaggtccacttatgcagttcctcaccaaagtttttaggcaacaaatccataacttgcggttctcttcctatccaatgtagcatccgctgaaatgttttaaatattttaagtaataaatgttgattcaaactcacctaggaagattaggaaggggaaaaaaagcacttggcatttaaatcttcagaagagaatttaatgacaggttcagcctgtttaatgacaagcccagcaccacacccctctcttatgatgtttcattattactgcataaatttcctttattactcatgataaataaaaataagatacctgacaaagtgggcgctcagggaaggcgggtgcgcgcctgcggggcggagatgggcagggggcggtgcgtgggtcccagtctgcagttaagggggcaggagtggcgctgctcacctctggtgccaaagggcggcgcagcggctgccgagctcggccctggaggcggcgagaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z