BBa_M36864 1 BBa_M36864 attP site for Bxb1 Integrase 2014-10-23T11:00:00Z 2015-05-08T01:14:06Z http://www.sciencedirect.com/science/article/pii/S0022283603013561 attB and attP are identified by Bxb1 integrase to determine the bounds for cutting. For an invertase switch, place attP, then the promoter of interest upstream, then att. upstream of the gene. When used in an invertase switch, Bxb1 cuts the intervening code and substitutes attL and attR sites at attB and attP, respectively. Bxb1 will not cut attL and attP sites without additional cofactors. false false _848_ 0 24144 9 Not in stock false May not be the most condensed attP sequence false Richard Fuisz annotation2429312 1 attP range2429312 1 1 40 BBa_M36864_sequence 1 ttcctcgttttctctcgttggaagaagaagaaacgagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z