BBa_M36907 1 IscA1 Coding Sequence of IscA1 pigeon homologue (codon-optimized for humans) 2015-10-24T11:00:00Z 2015-12-04T07:45:15Z The predicted IscA amino acid sequence was obtained from NCBI (http://www.ncbi.nlm.nih.gov/protein/XP_005508102.1), and codon-optimized for humans with IDT's tools. The gene Iron-Sulfur cluster assembly 1 (IscA1) is a mitochondrial protein involved in the biogenesis and assembly of iron-sulfur clusters, which play a role in electron-transfer reactions and is theorized to be associated with certain organisms' magnetic perception. The homing pigeon is one such organism with this ability, and here we have codon-optimized the Columba Livia homologue for homo sapiens. The sequence can be inserted into plasmids for expression of the magnetoreceptor IscA gene, which hopefully will create magnetogenetic biosensors in the form of iron-sulfur cluster, for downstream output and applications. false false _848_ 29123 29123 9 true While the plasmid design for this insert can be complicated, the coding sequence itself is quite simple. We only needed to remove the start codon in order to co-express a fluorescent protein, and modify two BbsII restriction enzyme sites by altering the third base pair of codons (wobble effect) at bp locations 75 (C->G) and 309 (A->G). false Michael Becich, Thomas Lau, Sreyas Misra BBa_M36907_sequence 1 atgctccatatcctggtatgcgcttctacgcactgcaaacagaagaatactcaaatcgacctgtatgttttcgtgttccagactcccagtgccgtgcagaagatcaaggagttgttgaaggacaaaccggaacatgtaggtgtgaaagtgggagtgagaacccggggttgcaacggtctttcttatacgctggaatataccaaatcaaagggggactctgacgaggaagtcgtgcaagacggagtgagagtctttattgagaaaaaggcccaactcaccctcctcggcactgagatggattacgtaggagacaagctgagtagcgaattcgtgtttaacaatccaaatataaagggaacatgcgggtgtggtgagtcttttaatata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z