BBa_M36920 1 BBa_M36920 Zinc Promoter (ZntR regulated) 2014-10-21T11:00:00Z 2015-05-08T01:14:07Z Registry. Promoter sequence with recognition site for ZntR transcriptional regulator protein. ZntR activates transcription when Zn(II) is bound (1). false false _848_ 0 24110 9 Not in stock false The ZntR regulated promoter has been cloned into the BBa_J61002-R0040 plasmid for construction of promoter basic parts and their derivatives. Insertion of a promoter element between the XbaI and SpeI sites resulted in a RFP reporter while retaining the ability to do biobrick assembly. false Leah Chase BBa_M36920_sequence 1 cgtccgctcgctgtatctctgataaaacttgactctggagttgactccagagtgtatccttcggttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z