BBa_M36927 1 BBa_M36927 strong transcription terminator apFAB7390 2013-06-08T11:00:00Z 2015-05-08T01:14:07Z BioFab # apFAB7390 This is a strong transcription terminator that can be used when you want to end transcription by RNA polymerase of a gene that is upstream. false false _848_ 0 17281 9 Not in stock false Changes to the sequence were made to optimize C-G content and codons, and minimize repeats for expression in E. coli. false Alexandra Ritchie BBa_M36927_sequence 1 tagagatcaagccttaacgaactaagacccccgcaccgaaaggtccgggggttttttttgaccttaaaaacataaccgaggagcagaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z