BBa_M36952 1 BBa_M36952 GSG + T2A Self-Cleaving Sequence 2015-10-23T11:00:00Z 2015-10-24T07:58:57Z Equine rhinitis A virus A T2A self-cleaving peptide sequence enhanced with a GSG linker false false _848_ 29120 29120 9 false Codon optimization for human cell lines false Amiel Stephen Paz BBa_M36952_sequence 1 ggttctggtgaaggccggggtagtctgttgacttgcggagatgtcgaagagaatccaggcccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z