BBa_M36983 1 BBa_M36983 Type II Secreted Antifreeze Actuator in E. coli (5-Repeat) Correct 2011-05-16T11:00:00Z 2015-05-08T01:14:07Z Pseudopleuronecta americanus (White Flounder) and E. Coli 5'UTR, signal peptide, non-glycolated antifreeze protein, and terminator that will as whole transcribe and secrete antifreeze protein outside the cell membrane. false false _848_ 0 9544 9 Not in stock false This composite part consists of a strong 5' UTR Sequence, followed by a signal peptide for secretion from E.coli, the non-glycolated AFP 5-mer, and finally a strong termination sequence. The 5' UTR and termination sequences are very strong because we want high transcription and only transcription of the region we coded before the termination sequence. The signal peptide is N-terminal and is native to E.coli. false Nathan Barnett, Meghan Bowler, Kian Torabian component2120059 1 BBa_M36999 component2120060 1 BBa_M36010 component2120050 1 BBa_M36981 component2120048 1 BBa_M36009 annotation2120059 1 BBa_M36999 range2120059 1 120 320 annotation2120048 1 BBa_M36009 range2120048 1 1 47 annotation2120050 1 BBa_M36981 range2120050 1 48 119 annotation2120060 1 BBa_M36010 range2120060 1 321 402 BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36981 1 BBa_M36981 Type II Signal Peptide (Correct) 2011-05-16T11:00:00Z 2015-05-08T01:14:07Z E.coli Signal peptide sequence isolated from E.coli. false false _848_ 0 9542 9 Not in stock false None false Meghan Bowler, Nathan Barnett, Kian Torabian annotation2119942 1 start range2119942 1 1 3 BBa_M36999 1 BBa_M36999 Non-Glycolated Antifreeze Protein (AFP) - 5-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:33Z Comes from the white flounder, or Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. Begins with a chain of C's and is followed by 5 rough repeats of "ANAAAAAALTA". The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This specific sequence has the repeat 5 times. Studies show that increasing the number of repeats increases the antifreeze capabilities of the protein. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119823 1 Unit 4 (TAANAAAAAAL) range2119823 1 145 177 annotation2119817 1 C-linker range2119817 1 1 9 annotation2119819 1 Modified Unit 0 (TASDAAAAAL) range2119819 1 16 45 annotation2119818 1 start range2119818 1 10 12 annotation2119820 1 Unit 1 (TAANAAAAAAL) range2119820 1 46 78 annotation2119822 1 Unit 3 (TAANAAAAAAL) range2119822 1 112 144 annotation2119824 1 stop range2119824 1 187 192 annotation2119821 1 Unit 2 (TAANAAAAAAL) range2119821 1 79 111 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36983_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaaatgaaagcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaaccccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcagcgaacgctgcagccgcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcacggtaataggatccgcgctcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36981_sequence 1 atgaaagcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaac BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa BBa_M36999_sequence 1 cccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcagcgaacgctgcagccgcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcacggtaataggatccgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z