BBa_M36988 1 BBa_M36988 Secreting Antifreeze Protein Correcting Reverse Primer 2011-06-07T11:00:00Z 2015-05-08T01:14:07Z Type II secretion protein (BBa_M36981). Spacer + Nsi1 + final 23 codons of the complimentary strand of the Type II secretion protein (BBa_M36981). false false _848_ 0 9543 9 Not in stock false Restriction enzyme is included so that the amplified sequence can be cloned into a plasmid. false Nathan Barnett annotation2120788 1 Nsi1 Restriction enzyme binding site range2120788 1 7 12 annotation2120787 1 Spacer range2120787 1 1 6 annotation2120789 1 Type II Signal Peptide (BBa_M36981) range2120789 1 13 35 BBa_M36988_sequence 1 gatcatatgcatgacagtcattcatctttctgccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z