BBa_M36989 1 BBa_M36989 Secreting Antifreeze Protein Correcting Forward Primer 2011-06-07T11:00:00Z 2015-05-08T01:14:07Z Designed off of 5'UTR (BBa_M36009) and Type II signal peptide (BBa_M36981) Spacer + Xba1 + 5???UTR (BBa_M36009) + added start codons (ATGAAA), followed by the next 18 codons in the signal peptide sequence from (BBa_M36981) false false _848_ 0 9543 9 Not in stock false Restriction enzyme was added to allow a cutting site for cloning of the amplified DNA sequence. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2120786 1 Type II Signal Peptide (BBa_M36981) range2120786 1 60 83 annotation2120784 1 5'UTR (BBa_M36009) range2120784 1 13 59 annotation2120785 1 start range2120785 1 60 62 annotation2120783 1 Xba1 Restriction binding site range2120783 1 7 12 annotation2120782 1 Spacer range2120782 1 1 6 BBa_M36989_sequence 1 tactagtctagatatagagggtattaataatgtatggattaaaaggggaggtataacaaatgaaagcgaccaaactggtgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z