BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36726 1 BBa_M36726 Type II Signal Peptide 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z This peptide is a genomic sequence from E. coli. An N-terminus peptide that carries and delivers a protein outside of the cell membrane using the Sec Pathway. false false _848_ 0 9543 9 Not in stock false This is an N-terminal protein that should precede the protein you would like exported. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119866 1 start range2119866 1 1 3 BBa_M36999 1 BBa_M36999 Non-Glycolated Antifreeze Protein (AFP) - 5-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:33Z Comes from the white flounder, or Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. Begins with a chain of C's and is followed by 5 rough repeats of "ANAAAAAALTA". The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This specific sequence has the repeat 5 times. Studies show that increasing the number of repeats increases the antifreeze capabilities of the protein. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119823 1 Unit 4 (TAANAAAAAAL) range2119823 1 145 177 annotation2119821 1 Unit 2 (TAANAAAAAAL) range2119821 1 79 111 annotation2119824 1 stop range2119824 1 187 192 annotation2119820 1 Unit 1 (TAANAAAAAAL) range2119820 1 46 78 annotation2119817 1 C-linker range2119817 1 1 9 annotation2119819 1 Modified Unit 0 (TASDAAAAAL) range2119819 1 16 45 annotation2119818 1 start range2119818 1 10 12 annotation2119822 1 Unit 3 (TAANAAAAAAL) range2119822 1 112 144 BBa_M36990 1 BBa_M36990 Type II Secreted Antifreeze Actuator in E. coli (5-Repeat) 2011-05-02T11:00:00Z 2015-05-08T01:14:07Z This sequence was obtained from the white flounder, Pseudopleuronecta americanus. 5'UTR, signal peptide, non-glycolated antifreeze protein, and terminator that will as whole transcribe and secrete antifreeze protein outside the cell membrane. false false _848_ 0 9543 9 Not in stock false none. false Nathan Barnett, Meghan Bowler, Kian Torabian component2120034 1 BBa_M36009 component2120045 1 BBa_M36999 component2120036 1 BBa_M36726 component2120046 1 BBa_M36010 annotation2120045 1 BBa_M36999 range2120045 1 114 314 annotation2120046 1 BBa_M36010 range2120046 1 315 396 annotation2120034 1 BBa_M36009 range2120034 1 1 47 annotation2120036 1 BBa_M36726 range2120036 1 48 113 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36726_sequence 1 gcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaac BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa BBa_M36999_sequence 1 cccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcagcgaacgctgcagccgcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcacggtaataggatccgcgc BBa_M36990_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaagcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaaccccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcagcgaacgctgcagccgcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcacggtaataggatccgcgctcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z