BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36726 1 BBa_M36726 Type II Signal Peptide 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z This peptide is a genomic sequence from E. coli. An N-terminus peptide that carries and delivers a protein outside of the cell membrane using the Sec Pathway. false false _848_ 0 9543 9 Not in stock false This is an N-terminal protein that should precede the protein you would like exported. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119866 1 start range2119866 1 1 3 BBa_M36997 1 BBa_M36997 Non-Glycolated Antifreeze Protein (AFP) - 1-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:22Z Comes from the white flounder, Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This is a reduced segment of the 5-Repeated Segment AFP, with four "ANAAAAAALTA" taken out. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119812 1 c-linker range2119812 1 1 9 annotation2119815 1 Unit 1 (TAANAAAAAAL) range2119815 1 46 78 annotation2119814 1 Modified Unit 0 (TASDAAAAAL) range2119814 1 16 45 annotation2119816 1 stop range2119816 1 91 96 annotation2119813 1 start range2119813 1 10 12 BBa_M36991 1 BBa_M36991 Type II Secreted Antifreeze Actuator in E. coli (1-Repeat) 2011-05-02T11:00:00Z 2015-05-08T01:14:07Z This sequence is based off of the antifreeze protein of the white flounder, Pseudopleuronecta americanus. 5'UTR, signal peptide, non-glycolated antifreeze protein, and terminator that will as whole transcribe and secrete antifreeze protein outside the cell membrane. false false _848_ 0 9543 9 Not in stock false This sequence is a shortened version of the 5-repeat Type II Secreted Antifreeze Actuator (BBa_M36990). false Nathan Barnett, Meghan Bowler, Kian Torabian component2120025 1 BBa_M36726 component2120023 1 BBa_M36009 component2120031 1 BBa_M36997 component2120032 1 BBa_M36010 annotation2120025 1 BBa_M36726 range2120025 1 48 113 annotation2120032 1 BBa_M36010 range2120032 1 216 297 annotation2120023 1 BBa_M36009 range2120023 1 1 47 annotation2120031 1 BBa_M36997 range2120031 1 114 215 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36726_sequence 1 gcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaac BBa_M36991_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaagcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaaccccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcacggtaataggatccgcgctcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa BBa_M36997_sequence 1 cccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcacggtaataggatccgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z