BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36726 1 BBa_M36726 Type II Signal Peptide 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z This peptide is a genomic sequence from E. coli. An N-terminus peptide that carries and delivers a protein outside of the cell membrane using the Sec Pathway. false false _848_ 0 9543 9 Not in stock false This is an N-terminal protein that should precede the protein you would like exported. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119866 1 start range2119866 1 1 3 BBa_M36996 1 BBa_M36996 Non-Glycolated Antifreeze Protein (AFP) - 10-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:52Z Based on the 5-repeated Segment AFP from the white flounder, Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. Begins with a chain of C's and is followed by 10 rough repeats of "ANAAAAAALTA". The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This sequence has 10 rough repeats of "ANAAAAAALTA", as compared to the natural peptide which has this sequence repeated roughly 5 times. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119802 1 Unit 1 (TAANAAAAAAL) range2119802 1 46 78 annotation2119808 1 Unit 7 (TAANAAAAAAL) range2119808 1 244 276 annotation2119806 1 Unit 5 (TAANAAAAAAL) range2119806 1 178 210 annotation2119801 1 Modified Unit 0 (TASDAAAAAL) range2119801 1 16 45 annotation2119803 1 Unit 2 (TAANAAAAAAL) range2119803 1 79 111 annotation2119809 1 Unit 8 (TAANAAAAAAL) range2119809 1 277 309 annotation2119810 1 Unit 9 (TAANAAAAAAL) range2119810 1 310 342 annotation2119799 1 C - linker range2119799 1 1 9 annotation2119804 1 Unit 3 (TAANAAAAAAL) range2119804 1 112 144 annotation2119811 1 stop range2119811 1 355 360 annotation2119800 1 start range2119800 1 10 12 annotation2119807 1 Unit 6 (TAANAAAAAAL) range2119807 1 211 243 annotation2119805 1 Unit 4 (TAANAAAAAAL) range2119805 1 145 177 BBa_M36992 1 BBa_M36992 Type II Secreted Antifreeze Actuator in E.coli (10-Repeat) 2011-05-02T11:00:00Z 2015-05-08T01:14:07Z This sequence is based off of the antifreeze protein of the white flounder, Pseudopleuronecta americanus. 5'UTR, signal peptide, non-glycolated antifreeze protein, and terminator that will as whole transcribe and secrete antifreeze protein outside the cell membrane. false false _848_ 0 9542 9 Not in stock false This sequence is an extended version of the 5-repeat Type II Secreted Antifreeze Actuator (BBa_M36990). false Meghan Bowler, Nathan Barnett, Kian Torabian component2120073 1 BBa_M36009 component2120075 1 BBa_M36726 component2120089 1 BBa_M36996 component2120090 1 BBa_M36010 annotation2120090 1 BBa_M36010 range2120090 1 483 564 annotation2120073 1 BBa_M36009 range2120073 1 1 47 annotation2120075 1 BBa_M36726 range2120075 1 48 113 annotation2120089 1 BBa_M36996 range2120089 1 114 482 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36996_sequence 1 cccccccccatggataccgcttccgatgctgctgcagctgctgcactcaccgctgcgaacgctgccgcggcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcagctaacgcggctgccgctgcagctttgactgcagccaatgccgcagcagcggcggctctgactgccgcgaatgctgcggcggccgctgcactcaccgctgccaacgccgctgctgctgcggctttgactgcagcaaacgcagcggctgcggctgccttgacagcagcaaatgcagctgcagctgctgctctgaccgctcggtaataggatccgcgc BBa_M36992_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaagcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaaccccccccccatggataccgcttccgatgctgctgcagctgctgcactcaccgctgcgaacgctgccgcggcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcagctaacgcggctgccgctgcagctttgactgcagccaatgccgcagcagcggcggctctgactgccgcgaatgctgcggcggccgctgcactcaccgctgccaacgccgctgctgctgcggctttgactgcagcaaacgcagcggctgcggctgccttgacagcagcaaatgcagctgcagctgctgctctgaccgctcggtaataggatccgcgctcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36726_sequence 1 gcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaac BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z