BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36996 1 BBa_M36996 Non-Glycolated Antifreeze Protein (AFP) - 10-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:52Z Based on the 5-repeated Segment AFP from the white flounder, Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. Begins with a chain of C's and is followed by 10 rough repeats of "ANAAAAAALTA". The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This sequence has 10 rough repeats of "ANAAAAAALTA", as compared to the natural peptide which has this sequence repeated roughly 5 times. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119807 1 Unit 6 (TAANAAAAAAL) range2119807 1 211 243 annotation2119804 1 Unit 3 (TAANAAAAAAL) range2119804 1 112 144 annotation2119803 1 Unit 2 (TAANAAAAAAL) range2119803 1 79 111 annotation2119811 1 stop range2119811 1 355 360 annotation2119799 1 C - linker range2119799 1 1 9 annotation2119805 1 Unit 4 (TAANAAAAAAL) range2119805 1 145 177 annotation2119808 1 Unit 7 (TAANAAAAAAL) range2119808 1 244 276 annotation2119802 1 Unit 1 (TAANAAAAAAL) range2119802 1 46 78 annotation2119800 1 start range2119800 1 10 12 annotation2119809 1 Unit 8 (TAANAAAAAAL) range2119809 1 277 309 annotation2119806 1 Unit 5 (TAANAAAAAAL) range2119806 1 178 210 annotation2119801 1 Modified Unit 0 (TASDAAAAAL) range2119801 1 16 45 annotation2119810 1 Unit 9 (TAANAAAAAAL) range2119810 1 310 342 BBa_M36726 1 BBa_M36726 Type II Signal Peptide 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z This peptide is a genomic sequence from E. coli. An N-terminus peptide that carries and delivers a protein outside of the cell membrane using the Sec Pathway. false false _848_ 0 9543 9 Not in stock false This is an N-terminal protein that should precede the protein you would like exported. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119866 1 start range2119866 1 1 3 BBa_M36993 1 BBa_M36993 Type II Secreted Antifreeze Actuator in E. coli (10-Repeat) 2011-04-27T11:00:00Z 2015-05-08T01:14:07Z Based on the sequence from the white flounder, Pseudopleuronecta americanus. 5'UTR, signal peptide, non-glycolated antifreeze protein, and terminator that will as whole transcribe and secrete antifreeze protein outside the cell membrane. true false _848_ 0 9543 9 Discontinued false This sequence has a 10 repeating unit of "ANAAAAAALTA", which is extended from the regular 5-repeat. false Nathan Barnett, Meghan Bowler, Kian Torabian component2118493 1 BBa_M36996 component2118491 1 BBa_M36009 component2118492 1 BBa_M36726 component2118494 1 BBa_M36010 annotation2118493 1 BBa_M36996 range2118493 1 130 495 annotation2118494 1 BBa_M36010 range2118494 1 504 585 annotation2118492 1 BBa_M36726 range2118492 1 56 121 annotation2118491 1 BBa_M36009 range2118491 1 1 47 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36993_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaatactagaggcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaactactagagcccccccccatggataccgcttccgatgctgctgcagctgctctcaccgctgcaaacgcagcagctgctgctgcactgaccgctgctaatgcagctgcagctgcagctctgactgcagctaacgctgcagctgcagcagctctcaccgctgctaacgcagctgctgcagctgctctgaccgctgcaaatgctgcagctgcagctgcactgaccgcagctaacgctgcagctgctgctgcactcaccgctgctaacgcagctgctgctgcagctctgactgcagctaatgctgctgcagcagctgcactgaccgctgcaaatgcagctgcagctgctgctctgaccgctcggtaataggatccgcgctactagagtcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36996_sequence 1 cccccccccatggataccgcttccgatgctgctgcagctgctgcactcaccgctgcgaacgctgccgcggcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcagctaacgcggctgccgctgcagctttgactgcagccaatgccgcagcagcggcggctctgactgccgcgaatgctgcggcggccgctgcactcaccgctgccaacgccgctgctgctgcggctttgactgcagcaaacgcagcggctgcggctgccttgacagcagcaaatgcagctgcagctgctgctctgaccgctcggtaataggatccgcgc BBa_M36726_sequence 1 gcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaac BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z