BBa_M36996 1 BBa_M36996 Non-Glycolated Antifreeze Protein (AFP) - 10-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:52Z Based on the 5-repeated Segment AFP from the white flounder, Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. Begins with a chain of C's and is followed by 10 rough repeats of "ANAAAAAALTA". The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This sequence has 10 rough repeats of "ANAAAAAALTA", as compared to the natural peptide which has this sequence repeated roughly 5 times. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119803 1 Unit 2 (TAANAAAAAAL) range2119803 1 79 111 annotation2119806 1 Unit 5 (TAANAAAAAAL) range2119806 1 178 210 annotation2119811 1 stop range2119811 1 355 360 annotation2119802 1 Unit 1 (TAANAAAAAAL) range2119802 1 46 78 annotation2119808 1 Unit 7 (TAANAAAAAAL) range2119808 1 244 276 annotation2119809 1 Unit 8 (TAANAAAAAAL) range2119809 1 277 309 annotation2119805 1 Unit 4 (TAANAAAAAAL) range2119805 1 145 177 annotation2119800 1 start range2119800 1 10 12 annotation2119807 1 Unit 6 (TAANAAAAAAL) range2119807 1 211 243 annotation2119804 1 Unit 3 (TAANAAAAAAL) range2119804 1 112 144 annotation2119799 1 C - linker range2119799 1 1 9 annotation2119810 1 Unit 9 (TAANAAAAAAL) range2119810 1 310 342 annotation2119801 1 Modified Unit 0 (TASDAAAAAL) range2119801 1 16 45 BBa_M36996_sequence 1 cccccccccatggataccgcttccgatgctgctgcagctgctgcactcaccgctgcgaacgctgccgcggcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcagctaacgcggctgccgctgcagctttgactgcagccaatgccgcagcagcggcggctctgactgccgcgaatgctgcggcggccgctgcactcaccgctgccaacgccgctgctgctgcggctttgactgcagcaaacgcagcggctgcggctgccttgacagcagcaaatgcagctgcagctgctgctctgaccgctcggtaataggatccgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z