BBa_M36998 1 BBa_M36998 Coenzyme B-12 Riboswitch for E. coli (nucleotides 1-240) 2011-04-27T11:00:00Z 2015-05-08T01:14:07Z Naturally-occurring, 240-nucleotides upstream of the btuB (B-12 uptake) coding sequence in E. coli. BtuB (the protein coded by the btuB gene) is a B-12 membrane transporter in E. coli bacteria. This part contains the full string of nucleotides for the coenzyme B-12 riboswitch present in Escherichia coli. The aptamer domain of the riboswitch (nucleotides 1-202) undergoes substantial allosteric changes upon binding coenzyme B-12 (aka hydroxocobalamin). The coenzyme B-12 aptamer has one of the most complex metabolite-binding structures of known naturally-occurring riboswitches, though other riboswitches with simpler aptamers can also sense their targets with impressive precision and use the resultant structural changes to control gene expression. Nucleotides 203-240 represent the 5'UTR (untranslated region) upstream of the btuB coding sequence in E. coli genome. false false _848_ 0 9648 9 Not in stock false An executive decision had to be made to include the 5'UTR region following the cobalamin ribowitch (aptamer) sequence. Nucleotides 203-240 represent the 5'UTR upstream of the btuB coding sequence. We chose to include these nucleotides in our part, as it is not completely clear what distinct role this region plays in translational control by the riboswitch, and few studies have demonstrated the significance of this region. false Nick Davis, Rachel RoseFigura annotation2119161 1 Shine-Dalgarno Sequence range2119161 1 210 237 annotation2119205 1 B12 box/B12 element range2119205 1 142 159 BBa_M36998_sequence 1 gccggtcctgtgagttaatagggaatccagtgcgaatctggagctgacgcgcagcggtaaggaaaggtgcgatgattgcgttatgcggacactgccattcggtgggaagtcatcatctcttagtatcttagatacccctccaagcccgaagacctgccggccaacgtcgcatctggttctcatcatcgcgtaatattgatgaaacctgcggcatccttcttctattgtggatgctttaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z