BBa_M36999 1 BBa_M36999 Non-Glycolated Antifreeze Protein (AFP) - 5-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:33Z Comes from the white flounder, or Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. Begins with a chain of C's and is followed by 5 rough repeats of "ANAAAAAALTA". The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This specific sequence has the repeat 5 times. Studies show that increasing the number of repeats increases the antifreeze capabilities of the protein. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119824 1 stop range2119824 1 187 192 annotation2119823 1 Unit 4 (TAANAAAAAAL) range2119823 1 145 177 annotation2119819 1 Modified Unit 0 (TASDAAAAAL) range2119819 1 16 45 annotation2119820 1 Unit 1 (TAANAAAAAAL) range2119820 1 46 78 annotation2119821 1 Unit 2 (TAANAAAAAAL) range2119821 1 79 111 annotation2119818 1 start range2119818 1 10 12 annotation2119822 1 Unit 3 (TAANAAAAAAL) range2119822 1 112 144 annotation2119817 1 C-linker range2119817 1 1 9 BBa_M36999_sequence 1 cccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcagcgaacgctgcagccgcagctgcactcaccgctgccaatgcagctgcagctgctgctctgactgccgcaaatgcggcggcggccgcggccttgacagcacggtaataggatccgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z