BBa_M39007 1 BBa_M39007 Promoter Sequence for NanR 2012-05-12T11:00:00Z 2015-05-08T01:14:07Z E.Coli Sequencing This is the promoter sequence for the NanR transcription factor in the Nan Operon. This Operon is for Sialic Acid Degradation. Promoter is for E.Coli false false _1206_ 0 13450 9 Not in stock false n/a false Edgar Aranda-Michel annotation2174766 1 NanR Binding Site range2174766 1 73 78 annotation2174768 1 NanR Binding Site range2174768 1 81 86 annotation2174767 1 +1 Site range2174767 1 78 78 annotation2174765 1 NanR Binding Site range2174765 1 64 69 BBa_M39007_sequence 1 tgccactttagtgaagcagatcgcattataagctttctgtatggggtgttgcttaattgatctggtataacaggtataaaggtatatcgtttatcagacaagcatcacttcagaggtattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z