BBa_K165002 1 BBa_K165002 Kozak sequence (yeast RBS) 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - Released HQ 2013 The kozak sequence acts as a eukaryotic RBS. It is cloned directly between a promoter and coding region. false false _267_ 0 2512 58 In stock false - false John Szymanski BBa_M39123 1 BBa_M39123 Glucose->Insulin 2012-05-11T11:00:00Z 2015-05-08T01:14:07Z CAP: E coli Promoter: E coli RBS: s cerevisiae Insulin: humans Terminator: s cerevisiae This device is made from several different parts taken from E. coli and Yeast. Our goal in creating this device was to be able to measure glucose levels and have the cells then produce an appropriate amount of insulin in response. To do this, we used the following parts: CAP binding site from the Lac Operon (taken from E. coli.), the Promoter found in the Lac Operon, a yeast ribosome binding site, the cDNA for human insulin, and a yeast terminator. We plan to use this device in yeast. As glucose is taken in, levels of cAMP increase. cAMP binds to the CAP binding site, facilitating the binding of RNA polymerase to the promoter and allowing transcription of the insulin gene. As glucose levels rise, so does that of cAMP, increasing the amount of insulin produced. Once glucose levels lower, cAMP lowers, and there is less insulin produced. true false _1206_ 0 13166 9 Discontinued false We had to figure out how to detect levels of glucose and respond to that accordingly. We solved this by looking at existing regulatory systems and modifying them to work in s cerevisiae. false Edgardo Farias component2174764 1 BBa_J63002 component2174762 1 BBa_K165002 annotation2174762 1 BBa_K165002 range2174762 1 1 18 annotation2174764 1 BBa_J63002 range2174764 1 27 251 BBa_J63002 1 tADH1 ADH1 terminator from S. cerevisiae 2006-10-10T11:00:00Z 2015-08-31T01:56:26Z genomic DNA of S. cerevisiae ADH1 terminator from S. cerevisiae false true _97_ 0 545 97 It's complicated false starts with stop codon false Caroline Ajo-Franklin annotation1902851 1 ADH1 terminator range1902851 1 1 225 BBa_M39123_sequence 1 cccgccgccaccatggagtactagagtaataagcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctctaccggcatgccgagcaaatgcctgcaaatcgctccc BBa_K165002_sequence 1 cccgccgccaccatggag BBa_J63002_sequence 1 taataagcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctctaccggcatgccgagcaaatgcctgcaaatcgctccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z