BBa_M39200 1 BBa_M39200 SP6 promoter for RNA polymerase 2012-05-14T11:00:00Z 2015-05-08T01:14:07Z Origin is unspecified. SP6 is a RNA polymerase dependent promoter. false false _1206_ 0 13167 9 Not in stock false N/A false Hannah Kempton BBa_M39200_sequence 1 atttaggtgacactatagaagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z