BBa_M39904 1 BBa_M39904 Human Insulin cDNA 2012-05-14T11:00:00Z 2015-05-08T01:14:08Z Comes from the human genome sequence. Found on this website http://www2.biglobe.ne.jp/~ashida/bioinfo/data/insdata.pdf This is the human insulin sequence with no introns. Since there are no introns, it can be easily integrated into bacterial genomes or plasmids to produce human insulin. Insulin is used to help store glucose. false false _1206_ 0 13166 9 Not in stock false Had to figure out which segments were introns and exons false Edgardo Farias BBa_M39904_sequence 1 agccctccaggacaggctgcatcagaagaggccatcaagcagtccttctgccatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctgtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactagacgcagcctgcaggcagccccacacccgccgcctcctgcaccgagagagatggaataaagcccttgaaccagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z