BBa_M41003 1 BBa_M41003 pAlkS2 promoter in Pseudomonas putida 2013-05-11T11:00:00Z 2015-05-08T01:14:08Z Canosa, I., et al. "A Positive Feedback Mechanism Controls Expression of AlkS, the Transcriptional Regulator of the Pseudomonas Oleovorans Alkane Degradation Pathway." Molecular microbiology 35.4 (2000): 791-9. It is a second promoter of AlkS gene. It is upregulated by AlkS-hydrocarbon complex formed in the presence of alkanes in the cell. false false _1503_ 0 16820 9 Not in stock false We cannot separate pAlkS1, pAlkS2 and AlkS gene because of self-regulatory system. false Hao Xing BBa_M41003_sequence 1 ttttaatatttaacaccgtaacctatggtgaaaatttccagtcagctggcgcgagaatagcata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z