BBa_M41007 1 BBa_M41007 AND Gate Promoter 2013-05-11T11:00:00Z 2015-05-08T01:14:08Z This part is based off of the genomic sequence of Salmonella typhimurium which has a similar promoter. The Axonal Myelination Initiator is an innovative device that promotes the production of myelin. The part receives inputs from two separate systems: the axon recognizing device, which produces the chaperone protein coded by the gene invF; and the axon-cell adhesion device, which produces the transcription factor coded by the gene sic A. The chaperone protein activates the otherwise inactive transcription factor and the complex promotes the transcription of myelin producing genes, successfully integrating two inputs to provide an extra level of control to the myelination system. The activated transcription complex binds to the listed sequence. false true _1503_ 0 17139 9 Not in stock false The promoter was designed in such a way as to initiate transcription of a gene cluster only when inputs are received from both the axon recognizing and adhesion devices. false Kerry Singh BBa_M41007_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggtgacagataacaggagtaagta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z