BBa_M41009 1 BBa_M41009 Genome sequence of long direct repeat sequence - D which encodes LdrD. 2013-05-13T11:00:00Z 2015-05-08T01:14:08Z Mitsuoki Kawano, Taku Oshima, Hiroaki Kasai, and Hirotada Mori. "Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli." Molecular Microbiology 45.2 (2002): 333???349. Web. LdrD is a 35-amino-acid peptide, over-expression of which will cause the condensation of the host cell and kill it. false false _1503_ 0 16820 9 Not in stock false There must be a point mutation in antitoxin promoters in order to use the toxin gene separately (198-203, 221-226). false Hao Xing BBa_M41009_sequence 1 aagccggaaaggttccggtgaggcgcaatgttgcgggggctttatccctggtggcattggttgctggagagagaaaacccccgcacgttgcaggtatgcacctgacaacaccacgggggctaatcttgactctagaccactcaagaatagccgcgaaacgttgtcattacaacacaggcggctatatgacgttcgcagagctgggcatggccttctggcatgatttagcggctccggtcattgctggcattcttgccagtatgatcgtgaactggctgaacaagcggaagtaacgtgtcatgcgggcgtcaggctgccgtaatggcaatttgcgcccggaccaggccgcaggggggaaactctgcggcctttttcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z