BBa_M41017 1 BBa_M41017 This sequence encodes a 64-nucleotide RNAi. 2013-05-13T11:00:00Z 2015-05-08T01:14:08Z Mitsuoki Kawano, Taku Oshima, Hiroaki Kasai, and Hirotada Mori. "Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli." Molecular Microbiology 45.2 (2002): 333???349. Web. The RNAi (RdlD) sequence is the inhibitor of the toxin (IdrD), which blocks the translation of the toxin. false false _1503_ 0 16820 9 Not in stock false Take off the original promoter and fuse it with LacI sequence. false Hao Xing annotation2217737 1 RNAi coding sequence range2217737 1 5 68 annotation2217736 1 Poly A tail range2217736 1 1 4 annotation2217738 1 Promoter range2217738 1 69 99 BBa_M41017_sequence 1 ttttgggggcgtgcaacgtccatacgtggactgttgtggtgcccccgattagaactgagatctggtgagttcttatcggcgctttgcaacagtaatgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z