BBa_M45022 1 BBa_M45022 SNAP-25 cleavage site for Botulism neurotoxin E 2015-04-16T11:00:00Z 2015-05-08T01:14:08Z Human Cleavage spot for botulism neurotoxin E on SNAP-25 protein from humans. false false _1855_ 0 26203 9 Not in stock false Codon optimized for Ecoli false Jason Peterson annotation2431116 1 Coding region range2431116 1 1 93 annotation2431081 1 Start range2431081 1 1 1 annotation2431115 1 End range2431115 1 93 93 BBa_M45022_sequence 1 attatcgggaacctgcgtcatatggcactggatatgggcaatgagatcgatacgcagaaccgtcaaattgatcgcattatggaaaaagcggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z