BBa_M45076 1 BBa_M45076 Aga2 gene protein 2014-04-11T11:00:00Z 2015-05-08T01:14:08Z Saccharomyces cerevisiae (baker's yeast) Yeast membrane protein false false _1855_ 0 20934 9 Not in stock false n/a false Yessica Castro annotation2372447 1 Translation stop range2372447 1 262 264 annotation2372446 1 Reverse primer binding range2372446 1 238 258 annotation2372445 1 Forward primer binding range2372445 1 79 99 annotation2372444 1 Tranlation start range2372444 1 1 3 BBa_M45076_sequence 1 atgcagttacttcgctgtttttcaatattttctgttattgcttcagttttagcacaggaactgacaactatatgcgagcaaatcccctcaccaactttagaatcgacgccgtactctttgtcaacgactactattttggccaacgggaaggcaatgcaaggagtttttgaatattacaaatcagtaacgtttgtcagtaattgcggttctcacccctcaacaactagcaaaggcagccccataaacacacagtatgttttttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z