BBa_M45113 1 BBa_M45113 Uranium Inducible (urcA) Promoter 2014-04-16T11:00:00Z 2015-05-08T01:14:08Z This part comes from Caulobacter crescentus CB15 section 318 of 359 of the complete genome, subsection 7998-8971, which may be found in Genbank at accession number AE005992.1 (Hillson et al., US Patent, Feb. 6 2008). Reference: Nathan J. Hillson, Ping Hu, Gary L. Andersen and Lucy Shapiro. Heavy Metal Biosensor. US Patent Application Publication. US20110117590. Feb. 6 2008. This reference was retrieved from: file:///C:/Users/Owner/Desktop/US20110117590.pdf The promoter was designated urcA for uranium response in the bacterium Caulobacter. It is activated in the presence of the uranyl cation, a soluble form of uranium (Hillson et al., 2007). The uranyl ion (UO2,2+ ) is the most water-soluble and bioavailable form of uranium and poses the greatest threat to human health. Due to the ease of uranyl ion spread through groundwater systems, most bioremediation strategies attempt to prevent contaminating uranium spread by utilizing microorganisms to reduce the oxidation state of uranium from U(VI), found in uranyl, to less soluble forms of uranium, including U(IV)(Hillson et al., 2007). The urcA promoter is speci&#64257;c for uranium and has little cross speci&#64257;city for nitrate (<400 M), lead (<150 M), cadmium (<48 M), or chromium (<41.6 M). It was induced 27.5-fold under uranium stress, but was not upregulated in response to other heavy metals in the test screen. For this reason, the urcA promoter was selected as a candidate to drive uranium reporter constructs(Hillson et al., 2007). Usually promoters from Caulobacter species will include at least one uranium-specific m_5 motif sequence. The urcA promoter contains two matches to this motif, located 107 and 55 bp upstream of the putative +1 site (Hillson et al., 2007). Reference: Nathan J. Hillson, Ping Hu, Gary L. Andersen and Lucy Shapiro. Caulobacter crescentus as a Whole-Cell Uranium Biosensor. Appl. Environ. Microbiol. 2007, 73(23):7615. DOI: 10.1128/AEM.01566-07. This reference was retrieved from: file:///C:/Users/Owner/Desktop/Appl.%20Environ.%20Microbiol.-2007-Hillson-7615-21.pdf false false _1855_ 0 20936 9 Not in stock false The sequence complied with RFC-10 standard assembly, so no design considerations had to be considered during the creation of the sequence as a biobrick. false Federico C. Rodriguez annotation2372450 1 Promoter range2372450 1 1 974 annotation2372452 1 Uranium-inducible m_5 motif 1 range2372452 1 825 851 annotation2372451 1 Uranium-inducible m_5 motif 2 range2372451 1 877 903 BBa_M45113_sequence 1 ggccggccgcacgcaagggcagatcatcggcctcggcgaaggttcgccccaggaagaagctgggattgagcggcttgtcacccttccggatctcgaaatggagatgcgagcccgaggaccgtccggaattgccgacgaaggcgacaatgtcgcctcgccgcaaataggcgccgcgcttcacgctacgggcgggacgggccagatgagcgtacagggtcgacagaccgcccttgtgcaccacaaggacatagcggccataggtggcgctgaccccggtggcctttacgacgccaggggccgcgaccttaacagctgcgccggcgggcgctgcgatatcaacgccctggtggagccgaccgctttcctcccacggcatctgtctcaagccgaagggcgaattgatgacccgccccggcaagggtgcgtcaaagacgaaggccgggggcggcgcctggacctcgggctccggtgcgggttgcgccaccgcagggatcgccgagctggtcggcgcgcgcgcaatccactcgctcatcgcgaccgcgccgttcaacgcgatcaccatcgcagcgatacccagcatcgagaagagcgcgacgcgcaagtgctgcggcgatagcgccaagctcatagagaccaaaaccacttcctcttcgacgcccggtcagtcgccaggaccgcgtctggacggttttgctctcatacttgacctttcgggatggtgaatcgacggcgtgcatgaatgtcgcatcgggcggaacggggcgtcgattaaccctttgcaaaccatatactcaaacgacccaagcaatatggtcacaaaaacttcaaacattacagactgtttagaatattaaagccccgtaattctcttaattacgcgtcatgactgaggtgtaacgagacttcgcgagaacccgaatgtatccaatattcatcggcgcagcgaacagcgcccagccagagggatacttcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z