BBa_M45116 1 BBa_M45116 GFPuv 2014-04-18T11:00:00Z 2015-05-08T01:14:08Z GFPuv comes was originally isolated from the bioluminescent jellyfish Aequorea Victoria (Chin et al.). Green fluorescent protein (GFP) is a 27 kDa protein of 238 amino acids in length. GFP is intrinsically fluorescent and hence is ideal as a non-invasive marker in living cells. It is used as a cell lineage tracer, reporter of gene expression, a measure of protein-protein interactions, and as an intracellular pH indicator. GFP can function as a protein tag as it tolerates N- and C-terminal fusion to a broad variety of proteins (Chin et al.). Wild-type GFP fluoresces maximally when excited at 395 nm, with a minor peak at 475 nm. Fluorescence emission peaks at 509 nm. It is stable within a range of pH 5.5 to 12. Denaturation occurs at temperatures above 70??C (Chin et al.). Several variants with improved absorption or emission spectra, or increased the fluorescence intensity, have since been developed. Variants also exhibit different thermosensitivities (Chin et al.). As stated before, the maximum excitation spectra of GFPuv is 395nm while its maximum emission spectra is 509nm, which is similar to that of wild-type GFP. Compared to wild-type GFP, GFPuv contains three amino acid substitutions (Phe-99 to Ser, Met-153 to Thr, and Val-163 to Ala [based on the amino acid numbering of wild-type GFP]), none of which alter the chromophore sequence. The main advantage of this variant over wild-type GFP is its large amount of fluorescence when excited by ultra-violet (UV) light at 395nm. GFPuv is 18 times brighter than wild-type GFP under ultra-violet excitation and can easily be detected by the eye without the need for specialized equipment. Furthermore, GFPuv expressed in E. coli is a soluble, fluorescent protein in contrast to wild-type GFP, much of which may be expressed as a nonfluorescent protein in inclusion bodies. Consequently, the GFPuv gene is expressed very efficiently in E. coli (Chin et al.). Reference: Chin et al. Characterization of Green Fluorescent Protein. Retrieved from: http://staff.science.nus.edu.sg/~scilooe/srp_2003/sci_paper/dbs/research%20_paper/ngeow_kao_chin.pdf false false _1855_ 0 20936 9 Not in stock false The sequence complied with RFC-10 assembly compatibility as a requirement for Utah State University Synthetic Biology class, so no design considerations had to be taken into account during the creation of the sequence as a biobrick. false Federico C. Rodriguez annotation2372549 1 Stop Codon range2372549 1 715 717 annotation2372547 1 Coding Sequence range2372547 1 1 717 annotation2372548 1 Start Codon range2372548 1 1 3 BBa_M45116_sequence 1 atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z