BBa_M45116 1 BBa_M45116 GFPuv 2014-04-18T11:00:00Z 2015-05-08T01:14:08Z GFPuv comes was originally isolated from the bioluminescent jellyfish Aequorea Victoria (Chin et al.). Green fluorescent protein (GFP) is a 27 kDa protein of 238 amino acids in length. GFP is intrinsically fluorescent and hence is ideal as a non-invasive marker in living cells. It is used as a cell lineage tracer, reporter of gene expression, a measure of protein-protein interactions, and as an intracellular pH indicator. GFP can function as a protein tag as it tolerates N- and C-terminal fusion to a broad variety of proteins (Chin et al.). Wild-type GFP fluoresces maximally when excited at 395 nm, with a minor peak at 475 nm. Fluorescence emission peaks at 509 nm. It is stable within a range of pH 5.5 to 12. Denaturation occurs at temperatures above 70??C (Chin et al.). Several variants with improved absorption or emission spectra, or increased the fluorescence intensity, have since been developed. Variants also exhibit different thermosensitivities (Chin et al.). As stated before, the maximum excitation spectra of GFPuv is 395nm while its maximum emission spectra is 509nm, which is similar to that of wild-type GFP. Compared to wild-type GFP, GFPuv contains three amino acid substitutions (Phe-99 to Ser, Met-153 to Thr, and Val-163 to Ala [based on the amino acid numbering of wild-type GFP]), none of which alter the chromophore sequence. The main advantage of this variant over wild-type GFP is its large amount of fluorescence when excited by ultra-violet (UV) light at 395nm. GFPuv is 18 times brighter than wild-type GFP under ultra-violet excitation and can easily be detected by the eye without the need for specialized equipment. Furthermore, GFPuv expressed in E. coli is a soluble, fluorescent protein in contrast to wild-type GFP, much of which may be expressed as a nonfluorescent protein in inclusion bodies. Consequently, the GFPuv gene is expressed very efficiently in E. coli (Chin et al.). Reference: Chin et al. Characterization of Green Fluorescent Protein. Retrieved from: http://staff.science.nus.edu.sg/~scilooe/srp_2003/sci_paper/dbs/research%20_paper/ngeow_kao_chin.pdf false false _1855_ 0 20936 9 Not in stock false The sequence complied with RFC-10 assembly compatibility as a requirement for Utah State University Synthetic Biology class, so no design considerations had to be taken into account during the creation of the sequence as a biobrick. false Federico C. Rodriguez annotation2372549 1 Stop Codon range2372549 1 715 717 annotation2372547 1 Coding Sequence range2372547 1 1 717 annotation2372548 1 Start Codon range2372548 1 1 3 BBa_M45113 1 BBa_M45113 Uranium Inducible (urcA) Promoter 2014-04-16T11:00:00Z 2015-05-08T01:14:08Z This part comes from Caulobacter crescentus CB15 section 318 of 359 of the complete genome, subsection 7998-8971, which may be found in Genbank at accession number AE005992.1 (Hillson et al., US Patent, Feb. 6 2008). Reference: Nathan J. Hillson, Ping Hu, Gary L. Andersen and Lucy Shapiro. Heavy Metal Biosensor. US Patent Application Publication. US20110117590. Feb. 6 2008. This reference was retrieved from: file:///C:/Users/Owner/Desktop/US20110117590.pdf The promoter was designated urcA for uranium response in the bacterium Caulobacter. It is activated in the presence of the uranyl cation, a soluble form of uranium (Hillson et al., 2007). The uranyl ion (UO2,2+ ) is the most water-soluble and bioavailable form of uranium and poses the greatest threat to human health. Due to the ease of uranyl ion spread through groundwater systems, most bioremediation strategies attempt to prevent contaminating uranium spread by utilizing microorganisms to reduce the oxidation state of uranium from U(VI), found in uranyl, to less soluble forms of uranium, including U(IV)(Hillson et al., 2007). The urcA promoter is speci&#64257;c for uranium and has little cross speci&#64257;city for nitrate (<400 M), lead (<150 M), cadmium (<48 M), or chromium (<41.6 M). It was induced 27.5-fold under uranium stress, but was not upregulated in response to other heavy metals in the test screen. For this reason, the urcA promoter was selected as a candidate to drive uranium reporter constructs(Hillson et al., 2007). Usually promoters from Caulobacter species will include at least one uranium-specific m_5 motif sequence. The urcA promoter contains two matches to this motif, located 107 and 55 bp upstream of the putative +1 site (Hillson et al., 2007). Reference: Nathan J. Hillson, Ping Hu, Gary L. Andersen and Lucy Shapiro. Caulobacter crescentus as a Whole-Cell Uranium Biosensor. Appl. Environ. Microbiol. 2007, 73(23):7615. DOI: 10.1128/AEM.01566-07. This reference was retrieved from: file:///C:/Users/Owner/Desktop/Appl.%20Environ.%20Microbiol.-2007-Hillson-7615-21.pdf false false _1855_ 0 20936 9 Not in stock false The sequence complied with RFC-10 standard assembly, so no design considerations had to be considered during the creation of the sequence as a biobrick. false Federico C. Rodriguez annotation2372450 1 Promoter range2372450 1 1 974 annotation2372451 1 Uranium-inducible m_5 motif 2 range2372451 1 877 903 annotation2372452 1 Uranium-inducible m_5 motif 1 range2372452 1 825 851 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_M45117 1 BBa_M45117 Uranium Inducible GFPuv Reporter 2014-04-18T11:00:00Z 2015-05-08T01:14:08Z This composite part comes from BBa_M45113 + BBa_B0034 + BBa_M45116 + BBa_B0010 + BBa_B0012. This composite part is made out of the uranium inducible (urcA)promoter (BBa_M45114), a ribosome binding site, the GFPuv protein which is a green fluorescent protein (GFP) variant optimized for excitation by UV light, and an extra stop codon to prevent RNA polymerase from reading it through. false false _1855_ 0 20936 9 Not in stock false The complete sequence complied with RFC-10 assembly compatibility as a requirement for Utah State University Synthetic Biology class, so no design considerations had to be taken into account during the creation of the sequence as a biobrick. false Federico C. Rodriguez component2372578 1 BBa_B0012 component2372575 1 BBa_M45116 component2372571 1 BBa_B0034 component2372576 1 BBa_B0010 component2372569 1 BBa_M45113 annotation2372575 1 BBa_M45116 range2372575 1 1001 1717 annotation2372578 1 BBa_B0012 range2372578 1 1814 1854 annotation2372571 1 BBa_B0034 range2372571 1 983 994 annotation2372569 1 BBa_M45113 range2372569 1 1 974 annotation2372576 1 BBa_B0010 range2372576 1 1726 1805 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_M45113_sequence 1 ggccggccgcacgcaagggcagatcatcggcctcggcgaaggttcgccccaggaagaagctgggattgagcggcttgtcacccttccggatctcgaaatggagatgcgagcccgaggaccgtccggaattgccgacgaaggcgacaatgtcgcctcgccgcaaataggcgccgcgcttcacgctacgggcgggacgggccagatgagcgtacagggtcgacagaccgcccttgtgcaccacaaggacatagcggccataggtggcgctgaccccggtggcctttacgacgccaggggccgcgaccttaacagctgcgccggcgggcgctgcgatatcaacgccctggtggagccgaccgctttcctcccacggcatctgtctcaagccgaagggcgaattgatgacccgccccggcaagggtgcgtcaaagacgaaggccgggggcggcgcctggacctcgggctccggtgcgggttgcgccaccgcagggatcgccgagctggtcggcgcgcgcgcaatccactcgctcatcgcgaccgcgccgttcaacgcgatcaccatcgcagcgatacccagcatcgagaagagcgcgacgcgcaagtgctgcggcgatagcgccaagctcatagagaccaaaaccacttcctcttcgacgcccggtcagtcgccaggaccgcgtctggacggttttgctctcatacttgacctttcgggatggtgaatcgacggcgtgcatgaatgtcgcatcgggcggaacggggcgtcgattaaccctttgcaaaccatatactcaaacgacccaagcaatatggtcacaaaaacttcaaacattacagactgtttagaatattaaagccccgtaattctcttaattacgcgtcatgactgaggtgtaacgagacttcgcgagaacccgaatgtatccaatattcatcggcgcagcgaacagcgcccagccagagggatacttcaa BBa_B0034_sequence 1 aaagaggagaaa BBa_M45116_sequence 1 atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_M45117_sequence 1 ggccggccgcacgcaagggcagatcatcggcctcggcgaaggttcgccccaggaagaagctgggattgagcggcttgtcacccttccggatctcgaaatggagatgcgagcccgaggaccgtccggaattgccgacgaaggcgacaatgtcgcctcgccgcaaataggcgccgcgcttcacgctacgggcgggacgggccagatgagcgtacagggtcgacagaccgcccttgtgcaccacaaggacatagcggccataggtggcgctgaccccggtggcctttacgacgccaggggccgcgaccttaacagctgcgccggcgggcgctgcgatatcaacgccctggtggagccgaccgctttcctcccacggcatctgtctcaagccgaagggcgaattgatgacccgccccggcaagggtgcgtcaaagacgaaggccgggggcggcgcctggacctcgggctccggtgcgggttgcgccaccgcagggatcgccgagctggtcggcgcgcgcgcaatccactcgctcatcgcgaccgcgccgttcaacgcgatcaccatcgcagcgatacccagcatcgagaagagcgcgacgcgcaagtgctgcggcgatagcgccaagctcatagagaccaaaaccacttcctcttcgacgcccggtcagtcgccaggaccgcgtctggacggttttgctctcatacttgacctttcgggatggtgaatcgacggcgtgcatgaatgtcgcatcgggcggaacggggcgtcgattaaccctttgcaaaccatatactcaaacgacccaagcaatatggtcacaaaaacttcaaacattacagactgtttagaatattaaagccccgtaattctcttaattacgcgtcatgactgaggtgtaacgagacttcgcgagaacccgaatgtatccaatattcatcggcgcagcgaacagcgcccagccagagggatacttcaatactagagaaagaggagaaatactagatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z