BBa_M45157 1 BBa_M45157 Amino acid sequence to produce MPT64 2016-04-19T11:00:00Z 2016-04-20T03:38:10Z original amino acid sequence was taken from M. tuberculosis. This is an amino acid sequence taken from Mycobacterium tuberculosis to produce the protein MPT64. The amino acid sequence has been changed to be E.coli-favorable, and restriction enzyme sites for EcoRI, PstI, SpeI, and XbaI have been removed. This sequence can be used as a means to produce protein MPT64 without culturing M. tuberculosis, and therefore can be used as a means to test for the presence of M. tuberculosis without the risk of the bacteria being in the lab. false false _1855_ 30812 30812 9 false The amino acid sequence has been changed to be E.coli-favorable, and the restriction enzyme sites for EcoRI, PstI, SpeI, and XbaI have been removed. false Cynthia Hanson annotation2479073 1 stop range2479073 1 685 687 annotation2479074 1 start range2479074 1 1 3 BBa_M45157_sequence 1 atgcgcatcaaaatcttcatgctcgttacagcagttgtactgctgtgctgttccggtgtcgctacagcagcaccgaaaacttactgtgaggaacttaaaggcacagatactggccaggcttgtcagattcagatgtctgatcctgcatataatatcaatatttcactgccgagctattacccagatcagaagtccctggaaaattatattgcacagactcgtgataaatttctgtcggcggctacttcaagtactccacgcgaggcaccttacgagctgaatataactagcgcgacttatcagagtgctatcccaccccgcggtactcaagctgtggtgctgaaagtgtaccaaaacgctggaggaacccatccaaccacaacatataaagcatttgattgggatcaagcttatcgcaaaccgatcacatacgacaccctttggcaggctgacacggatccgctgcccgttgtttttcctattgtgcagggggaactgagtaagcaaacaggtcagcaggtctctatagccccgaatgccggcctggatcctgtgaattaccaaaattttgcggttacgaatgacggagtgatttttttctttaaccctggtgaactcttgccggaggcagcaggtcctacgcaggtactggtaccgcgtagcgccatcgacagtatgctggcgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z