BBa_M45191 1 BBa_M45191 Salmonella invasion promoter 2016-04-15T11:00:00Z 2016-04-22T11:04:05Z Whole-genome sequence of Salmonella species Promoter sequence from a gene contained in the SPI-I that is necessary for the assimilation into eukaryotic cells. Promoter is activated by HilD transcription factor. false false _1855_ 30474 30474 9 false None false Thomas Harris annotation2479121 1 Promoter range2479121 1 10 39 annotation2478764 1 -35 Box range2478764 1 10 15 annotation2478765 1 -10 Box range2478765 1 34 39 BBa_M45191_sequence 1 tattttgcattgccacttaatatcaatataattattatagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z