BBa_M45196 1 BBa_M45196 Salmonella invasion gene invR for amoeba 2016-04-17T11:00:00Z 2016-04-23T05:34:13Z Genomic sequence of S. typhimurium LT2 This part enables the product to enter the amebea. The invasion gene in salmonella. false false _1855_ 30474 30476 9 false No design for the sequence. false Alexis Houghton annotation2478772 1 Start Codon range2478772 1 1 3 annotation2479156 1 Coding Region range2479156 1 1 101 annotation2478773 1 Stop Codon range2478773 1 99 101 BBa_M45196_sequence 1 atggtcacttttacggttggccatttgtctcttacgttgcatttatcaatctgctttttgatacagcagcacctcgctgctgctttttttatttgtgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z