BBa_M45214 1 BBa_M45214 Physcomitrella patens ribosome binding site 2016-04-15T11:00:00Z 2016-04-16T01:01:24Z From genbank: Physcomitrella patens subsp. patens predicted protein (PHYPADRAFT_173331) mRNA, complete cds. This sequence is the DNA sequence between the transcription start and translation start sites on a dehydrin protein gene found in P. patens. While it is true that this entire sequence may not be involved in ribosome binding, it is clear that this sequence contains key elements for ribosome binding and even more specifically a ribosome binding site that is native to P. patens. false false _1855_ 23449 23449 9 false Only the sequence between the transcription and translation start sites were taken into consideration. false Cody Maughan annotation2478748 1 Possible Ribosome Binding Site range2478748 1 73 79 annotation2478749 1 Possible Ribosome Binding Site (right before translation start) range2478749 1 201 207 BBa_M45214_sequence 1 accatcgacagaaccatatccactcgattcatggcagcttttgacgaccatccctagttccgatcacgcacgcacaccggctttgccacgcataccgacttgattgcagtcacagcgcttgccgcgacgccaatccgttcccttgtaccgcatcctgacatttgtccattcgtgtttttgttttttgggttttgagttttgatcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z