BBa_M45407 1 BBa_M45407 C120 2015-04-18T11:00:00Z 2015-05-08T01:14:09Z http://www.nature.com/nchembio/journal/v10/n3/full/nchembio.1430.html#supplementary-information EL222-binding clone 1???20 bp (C120) false false _1855_ 0 25512 9 Not in stock false Five repeats of this sequence is used for the binding of EL222 protein false Farhad Farjood BBa_M45407_sequence 1 taggtagcctttagtccatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z