BBa_M45417 1 NLS Nuclear Localization Sequence 2015-04-09T11:00:00Z 2015-05-08T01:14:09Z Synthetically created part. Protein tag that can be used to transport the protein into the cell nucleus. false false _1855_ 0 25682 9 Not in stock false No issues were encountered. false Andrew Vanderwerf annotation2430780 1 Coding sequence range2430780 1 1 27 annotation2430779 1 Start Codon range2430779 1 1 3 BBa_M45417_sequence 1 atgggccctaaaaagaagcgtaaagtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z