BBa_I746360 1 BBa_I746360 PF promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z The original source is the P2 phage genome. For our work the DNA came from plasmids, kindly supplied to us by Prof. Calendar, University of California (Berkeley): Bacteriophage PSP3 and fR73 Activator Proteins: Analysis of Promoter Specificities; Julien and Calendar, 1996; JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5668???5675 Released HQ 2013 This is the PF promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PF promoter. false false _116_ 0 2122 9 In stock false no special considerations seemed necessary true Stefan Milde annotation1943783 1 PF range1943783 1 1 91 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_M45503 1 BBa_M45503 PF + RBS 2015-04-20T11:00:00Z 2015-05-08T01:14:09Z bla wwwwww false false _1855_ 0 25693 9 Not in stock false ha false Angela Akude component2431465 1 BBa_B0034 component2431463 1 BBa_I746360 annotation2431465 1 BBa_B0034 range2431465 1 100 111 annotation2431463 1 BBa_I746360 range2431463 1 1 91 BBa_B0034_sequence 1 aaagaggagaaa BBa_M45503_sequence 1 ttgcccgccttttctttaccggtggttgtgctgtcgattagccaaccgggacaaatagcctgacatctccggcgcaactgaaaataccacttactagagaaagaggagaaa BBa_I746360_sequence 1 ttgcccgccttttctttaccggtggttgtgctgtcgattagccaaccgggacaaatagcctgacatctccggcgcaactgaaaataccact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z