BBa_I746352 1 BBa_I746352 delta activator from phiR73 phage 2007-09-11T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The delta activator taken from phiR73 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943873 1 phiR73 delta range1943873 1 22 22 annotation1943874 1 silent mutation to remove PstI site range1943874 1 102 102 annotation1943871 1 B0034 range1943871 1 1 12 annotation1943872 1 phiR73 delta range1943872 1 22 264 BBa_I12007 1 Prm + Modified lambda Prm promoter (OR-3 obliterated) 2004-07-14T11:00:00Z 2015-08-31T04:07:31Z Shih and Gussin (1983) Released HQ 2013 Lambda Prm promoter modified to be activated but not repressed by the lambda repressor (cI) false true _3_ 0 103 7 In stock false In wild type lambda phage, the OR3 site (-27 to -11) reads "tatcccttgcggtgata" on the sense strand of DNA. To prevent lambda repressor (cI) from binding to this site, the 4th through 10th nt of OR3 were replaced by the 7 nt between OR2 and OR1, "aaatagt" (-57 to -51), which in effect mutates 5 nt of the promoter. These nt were chosen to be about halfway between the -10 and -35 boxes of the promoter. Furthermore, since these nt already act as a spacer in wild-type phage, it is hoped they will not create undesired interactions. true Hans annotation937702 1 OR2 range937702 1 33 49 annotation937701 1 OR1 range937701 1 9 25 annotation937704 1 mutate to obliterate OR3 range937704 1 59 65 annotation937705 1 -10 range937705 1 71 76 annotation937703 1 -35 range937703 1 48 53 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_M45505 1 BBa_M45505 pRM promoter with phiR73 delta that is used to activate the promoter PF 2015-04-22T11:00:00Z 2015-05-08T01:14:09Z phiR73 phage, Lambda phage Lambda Prm promoter was modified to be activated but not repressed by the lambda repressor Cl. This gives the promoter the ability to be sense when a phage has infected the cell. The delta activator, designed by Cambridge 2007, was taken from phiR73 phage and acts on a class of inducible promoters (parts I746360 to I746365). The part sequence does already contain a ribosome binding site (B0034). A double stop codon B0015 is also added to the back of the part. false false _1855_ 0 23424 9 Not in stock false none false Dallin V. Christensen component2431619 1 BBa_I12007 component2431624 1 BBa_I746352 component2431631 1 BBa_B0015 annotation2431624 1 BBa_I746352 range2431624 1 91 354 annotation2431619 1 BBa_I12007 range2431619 1 1 82 annotation2431631 1 BBa_B0015 range2431631 1 363 491 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I12007_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt BBa_M45505_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagaaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I746352_sequence 1 aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z