BBa_M45606 1 BBa_M45606 mOG2 (eukaryotes) 2015-04-10T11:00:00Z 2015-05-08T01:14:09Z Homo sapiens promoter of osteocalcin gene mOG2 promoter regulates expression of osteocalcin gene and expression changes in response to the amount of ascorbic acid in the cell environment. false false _1855_ 0 25618 9 Not in stock false only for eukaryotes false Anna Doloman annotation2430834 1 bind an osteoblast specific factor range2430834 1 41 49 annotation2430836 1 osteoblast promoter range2430836 1 1 224 annotation2430835 1 binding site range2430835 1 86 90 BBa_M45606_sequence 1 ctagtccactcccagagccttgcccaggcagctgcaatcaccaaccacagcatcctttgggtttgacccactgagcacatgacccccaattagtcctggcagcatcccctgctcctcctgcttacatcagagagcacagagtagccgatataaatgctactggatgctggagggtgcagaacagacaagtcccacacagcagcttggtgcacacctagcagaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z