BBa_M45632 1 BBa_M45632 A device to sense Vitamin D3 2015-04-12T11:00:00Z 2015-05-08T01:14:09Z Device is composed of various standard parts. See each part description for details. A composite part to report the amount of vitamin D3 in the media. Sensing is based on the quenching of the expression of blue chromoprotein, with increase of the concentration of vitamin D3. false false _1855_ 0 25618 9 Not in stock false No design consideratins false Anna Doloman component2430913 1 BBa_K1033919 component2430907 1 BBa_K364312 component2430904 1 BBa_K525998 component2430911 1 BBa_M45603 component2430914 1 BBa_K784002 component2430906 1 BBa_B0034 annotation2430907 1 BBa_K364312 range2430907 1 61 345 annotation2430914 1 BBa_K784002 range2430914 1 1052 1098 annotation2430913 1 BBa_K1033919 range2430913 1 375 1043 annotation2430904 1 BBa_K525998 range2430904 1 1 32 annotation2430911 1 BBa_M45603 range2430911 1 354 368 annotation2430906 1 BBa_B0034 range2430906 1 41 52 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K364312 1 BBa_K364312 Human VDR hinge region 2010-09-29T11:00:00Z 2015-05-08T01:12:14Z Human VDR (of the nuclear hormone receptor superfamily) the vitamin D receptor (VDR) and also known as NR1I1 (nuclear receptor subfamily 1, group I, member 1), is a member of the nuclear receptor family of transcription factors. Upon activation by vitamin D, the VDR forms a heterodimer with the retinoid-X receptor and binds to hormone response elements on DNA resulting in expression or transrepression of specific geneproducts. In humans, the vitamin D receptor is encoded by the VDR gene. Hinge region: Thought to be a flexible domain that connects the DBD with the LBD. Influences intracellular trafficking and subcellular distribution. false false _486_ 0 6778 9 It's complicated true The reconstruction of the DBD to the hinge region and LBD will be done with RFC 25. false Lior Malka BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2127788 1 B0034 range2127788 1 21 32 annotation2129432 1 T7 promoter range2129432 1 1 20 annotation2129433 1 RBS range2129433 1 24 27 BBa_K784002 1 BBa_K784002 T7 Terminator 2012-09-12T11:00:00Z 2015-05-08T01:13:21Z http://nar.oxfordjournals.org/content/suppl/2012/06/05/gks597.DC1/nar-00461-c-2012-File007.pdf This part is a T7 RNAP Terminator, which can also be used for the following RNAP: T3,N4,K1F,SP6. false false _1039_ 0 11982 9 Not in stock false no particular design considerations false Lior Levy BBa_K1033919 1 gfasPurple gfasPurple, purple chromoprotein 2013-08-24T11:00:00Z 2015-05-08T01:08:49Z The coral Galaxea fascicularis. This chromoprotein from the coral Galaxea fascicularis, gfasPurple, naturally exhibits strong color when expressed. false false _1340_ 0 10137 9 Not in stock false Synthesized and codon optimized for E coli by GenScript. false Sabri Jamal annotation2332104 1 gfasPurple range2332104 1 1 666 BBa_M45603 1 BBa_M45603 VDRE 2015-03-27T12:00:00Z 2015-05-08T01:14:09Z course file check#1_AD false false _1855_ 0 25618 9 Not in stock false just do it) false Anna Doloman annotation2430595 1 protein binding site range2430595 1 1 15 annotation2430612 1 conserved domain range2430612 1 1 15 annotation2430602 1 regulates transcription range2430602 1 1 15 BBa_B0034_sequence 1 aaagaggagaaa BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_M45632_sequence 1 taatacgactcactatagggaaagaggagaaatactagagaaagaggagaaatactagaggatgaagaagtgcagcggaagcgcgagatgatcctgaagcggaaagaggaagaggccctgaaggacagcctgcggcccaagctgagcgaggaacagcagcggatcattgccatcctgctggacgcccaccacaagacctacgaccccacctacagcgatttctgccagttcagaccccccgtgcgcgtgaacgatggcggcggaagccacccctctcggcccaatagcagacacacccccagcttcagcggcgacagcagctctagctgtagcgaccactgtatctactagagtcagctccttctccttactagatgtcggtgattgctaaacagatgacctacaaagtctatatgtcgggtacggtgaacggccattattttgaagttgaaggtgacggtaaaggcaagccgtatgaaggcgaacagaccgttaaactgaccgtcacgaagggcggtccgctgccgtttgcatgggatattctgagtccgcagtcccaatatggcagcatcccgttcacgaaatatccggaagatatcccggactacgtgaagcagtcttttccggaaggttacacctgggaacgtatcatgaacttcgaagatggcgccgtctgcaccgtgagtaacgacagctctattcaaggtaattgtttcatctaccatgtcaagttctcaggtctgaacttcccgccgaatggcccggtgatgcagaaaaagacccaaggctgggaaccgaatacggaacgtctgtttgcacgcgatggtatgctgattggcaacaatttcatggctctgaaactggaaggcggtggccactatctgtgcgaatttaaaagcacctacaaggcgaaaaagccggttaaaatgccgggctatcattacgtggatcgtaaactggacgttaccaaccacaataaggactatacgtccgtcgaacagtgtgaaatttcaatcgcgcgcaaatcggtggttgcctaataatactagagtagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_K364312_sequence 1 gatgaagaagtgcagcggaagcgcgagatgatcctgaagcggaaagaggaagaggccctgaaggacagcctgcggcccaagctgagcgaggaacagcagcggatcattgccatcctgctggacgcccaccacaagacctacgaccccacctacagcgatttctgccagttcagaccccccgtgcgcgtgaacgatggcggcggaagccacccctctcggcccaatagcagacacacccccagcttcagcggcgacagcagctctagctgtagcgaccactgtatc BBa_M45603_sequence 1 tcagctccttctcct BBa_K784002_sequence 1 tagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_K1033919_sequence 1 atgtcggtgattgctaaacagatgacctacaaagtctatatgtcgggtacggtgaacggccattattttgaagttgaaggtgacggtaaaggcaagccgtatgaaggcgaacagaccgttaaactgaccgtcacgaagggcggtccgctgccgtttgcatgggatattctgagtccgcagtcccaatatggcagcatcccgttcacgaaatatccggaagatatcccggactacgtgaagcagtcttttccggaaggttacacctgggaacgtatcatgaacttcgaagatggcgccgtctgcaccgtgagtaacgacagctctattcaaggtaattgtttcatctaccatgtcaagttctcaggtctgaacttcccgccgaatggcccggtgatgcagaaaaagacccaaggctgggaaccgaatacggaacgtctgtttgcacgcgatggtatgctgattggcaacaatttcatggctctgaaactggaaggcggtggccactatctgtgcgaatttaaaagcacctacaaggcgaaaaagccggttaaaatgccgggctatcattacgtggatcgtaaactggacgttaccaaccacaataaggactatacgtccgtcgaacagtgtgaaatttcaatcgcgcgcaaatcggtggttgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z