BBa_M45643 1 BBa_M45643 Phenol hydroxylase component 1 gene 2015-04-12T11:00:00Z 2015-05-08T01:14:09Z Arhodomonas sp. Seminole phenol hydroxylase component 1 gene ORF 1080 corresponding to components of phenol hydroxylase, involved in the degradation of phenols false false _1855_ 0 26376 9 Not in stock false no design consideration false Hossein Jahromi annotation2430845 1 stop range2430845 1 273 276 annotation2430844 1 start range2430844 1 1 3 annotation2430843 1 coding sequence range2430843 1 1 276 BBa_M45643_sequence 1 atggcgaacaacaacgtcttcatcgcgcttcagaacaacgaggaggcgcgacccatcatcgaggccatcgagcaggacaacgccgaggcccgtgtcgagtacgccccggccatggtcaagatcgacgcgcccgggcggatcgcggtccgccgcgagacggtcgaggacctgatcggccgcgactgggacccccaggagctgcatgtcaatctcatctcgctgtcgggaaacatcgacgaggacgacgacgcgttcgttatccatcgcggcgactga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z