BBa_M45689 1 BBa_M45689 Constitutive promoter with a retinoic acid response element at the end 2015-04-13T11:00:00Z 2015-05-08T01:14:09Z The promoter used is from the LacIQ promoter from E. coli, and the retinoic acid response element(RARE) from the homo sapien genome. This promoter is designed to constantly be on except in the presence of both the retinoic acid receptor protein and retinoic acid. false false _1855_ 0 25689 9 Not in stock false Had to considered whether the response element would interfere with the promoter activity with no retinoic acid present. false Spencer Williams annotation2430942 1 RARE range2430942 1 54 71 annotation2430941 1 -10 Box range2430941 1 24 30 annotation2430940 1 -35 Box range2430940 1 3 8 BBa_M45689_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcaggaggtcaccaggaggtca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z