BBa_M45699 1 BBa_M45699 Vitamin D receptor with red chromoprotein reporter 2015-04-09T11:00:00Z 2015-05-08T01:14:09Z Part:BBa_K364329 and BBa_K592012 Estrogen receptor DBD - Vitamin D receptor hinge region - Estrogen receptor LBD Artificial eukaryotic TF made of Estrogen receptor's DBD (DNA Binding Domain), a vitamin D3 receptor hinge domain and H. sapiens nuclear hormone receptor LBD (Ligand Binding Domain) Human Estrogen Receptor ER-α is a 17β-estradiol-activated steroid receptor member of the nuclear receptor superfamily of transcription factors. It has a variety of central physiological roles, including those involved in maintenance of the reproductive, cardiovascular, musculoskeletal and central nervous systems. ER-α is expressed at low to moderate levels in major physiological systems (central nervous system (CNS), endocrine, metabolic, gastrointestinal, immune, reproductive, cardiovascular, respiratory and structural), with peaks of expression in the pituitary, ovary, uterus and vas deferens. ER-α dysfunction is associated with cancer, cardiovascular system defects, hematological system defects, immune and inflammation diseases, metabolic defects, reproductive defects. This composite artificial transcription factor will activate any reporter or any gene in general that has a UAS (Upper Activating Sequence) 3' of its promoter. The usual binding sites of reporters, contain multiple UAS elements. In order to have a POPS output, the LBD has to recruit activators in the cell. This can be initiated by ligand binding or by recruiting a protein that has a fused strong activator like the VP activator. With this system NHR (Nuclear Hormone Receptor) ligands or NHR interacting partners can be screened. The NHR: cofactor-VP interaction should be also broken by a potential ligand binding, this is why this setup is also suitable for ligand identification. The benefit of the cofactor-VP interaction test is that the dynamic range of the assay is much higher than the dynamic range of the normal Gal4-NHR ligand activation assay. More info about this project on the wiki pages of Team Debrecen-Hungary 2010 [1] This chromoprotein eforRed naturally exhibits red/pink color when expressed. The color is slightly weaker than RFP. On agar plates and in liquid culture, the color is readily visible to naked eye in less than 24 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _1855_ 0 26247 9 Not in stock false NA false han zhang annotation2430823 1 stop range2430823 1 962 964 annotation2430824 1 promoter with Vd binding site range2430824 1 1 280 annotation2430822 1 start range2430822 1 281 283 annotation2430825 1 reporter range2430825 1 281 964 BBa_M45699_sequence 1 gatgaagaagtgcagcggaagcgcgagatgatcctgaagcggaaagaggaagaggccctgaaggacagcctgcggcccaagctgagcgaggaacagcagcggatcattgccatcctgctggacgcccaccacaagacctacgaccccacctacagcgatttctgccagttcagaccccccgtgcgcgtgaacgatggcggcggaagccacccctctcggcccaatagcagacacacccccagcttcagcggcgacagcagctctagctgtagcgaccactgtatcatgtcagtgattaagcaggtaatgaagaccaagttgcaccttgagggcactgtcaatggccatgattttacgatcgagggtaaaggtgaaggcaagccgtacgaagggttacagcacatgaaaatgacagtcaccaaaggcgcgcctctgccgttttccgttcatattcttacacctagccacatgtatggaagcaaaccgtttaataagtatccagcggatatcccagactaccacaaacagtcttttcccgaaggtatgtcttgggagcggtcgatgatttttgaagatggtggcgtatgcaccgccagtaatcactccagcataaacttgcaagagaactgtttcatctatgatgttaaatttcatggtgtgaacctgcctccggatgggcccgtaatgcaaaaaaccattgctggatgggagccgagcgtggaaacactgtacgtgcgtgacgggatgttaaaaagtgacactgcaatggtttttaaactgaaaggaggcggtcatcatcgtgttgatttcaaaacgacgtataaagccaaaaaacctgtcaagctgccagaatttcatttcgttgaacatcgcctggaactgaccaaacacgataaagatttcacaacttgggaccagcaggaggcagccgaaggccatttctcaccgctgccgaaggctctcccatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z