BBa_M45711 1 BBa_M45711 Hd1a toxin from Haplopelma doriae spider 2015-04-18T11:00:00Z 2015-05-08T01:14:09Z This sequence comes from the Haplopelma doriae spider. http://onlinelibrary.wiley.com/doi/10.1111/bph.13081/full Hd1a shows signs of being possibly used as another analgesic. It effectively blocks the Nav1.7 sodium channel and thus is an effective pain blocker. false false _1855_ 0 23855 9 Not in stock false This sequence has been codon optimized for RC 10. false Nicholas D. Lauritzen annotation2431527 1 Hd1a range2431527 1 1 105 BBa_M45711_sequence 1 gcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z