BBa_M45712 1 BBa_M45712 Hd1a toxin from Haplopelma doriae spider with start codon 2015-04-21T11:00:00Z 2015-05-08T01:14:09Z This sequence comes from the Haplopelma doriae spider. http://onlinelibrary.wiley.com/doi/10.1111/bph.13081/full Hd1a shows signs of being possibly used as another analgesic. It effectively blocks the Nav1.7 sodium channel and thus is an effective pain blocker. false false _1855_ 0 23855 9 Not in stock false The ATG start codon was added to the beginning of the sequence. false Nicholas D. Lauritzen annotation2431529 1 Hd1a range2431529 1 4 108 annotation2431528 1 Start Codon range2431528 1 1 3 BBa_M45712_sequence 1 atggcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z