BBa_M45750 1 BBa_M45750 P-rbs-10xhis-EPS-Hd1a-Stop 2015-04-21T11:00:00Z 2015-05-08T01:14:09Z It is peptide &#956;-TRTX-Hd1a from the venom of Haplopelma doriae. Codes for the Hd1a protein which blocks sodium channels, specifically Nav1.1 and Nav1.7, and can be used as an analgesic. A 10x histidine has been included for purification, and an enterokinase protease site has been included to cleave off the histidine tag after purification. false false _1855_ 0 25686 9 Not in stock false This part has been optimized for use in E. coli. false Alex Torgesen component2431542 1 BBa_K1162009 component2431540 1 BBa_K208010 component2431544 1 BBa_M45751 component2431553 1 BBa_B0015 component2431546 1 BBa_M45711 annotation2431544 1 BBa_M45751 range2431544 1 268 282 annotation2431542 1 BBa_K1162009 range2431542 1 227 259 annotation2431540 1 BBa_K208010 range2431540 1 1 220 annotation2431553 1 BBa_B0015 range2431553 1 404 532 annotation2431546 1 BBa_M45711 range2431546 1 291 395 BBa_M45711 1 BBa_M45711 Hd1a toxin from Haplopelma doriae spider 2015-04-18T11:00:00Z 2015-05-08T01:14:09Z This sequence comes from the Haplopelma doriae spider. http://onlinelibrary.wiley.com/doi/10.1111/bph.13081/full Hd1a shows signs of being possibly used as another analgesic. It effectively blocks the Nav1.7 sodium channel and thus is an effective pain blocker. false false _1855_ 0 23855 9 Not in stock false This sequence has been codon optimized for RC 10. false Nicholas D. Lauritzen annotation2431527 1 Hd1a range2431527 1 1 105 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_M45751 1 BBa_M45751 Enterokinase protease site 2015-04-21T11:00:00Z 2015-05-08T01:14:09Z It comes from the intestines where enterokinase recognizes the site and cuts trypsinogen into its active form of trypsin. This is the recognition site for enterokinase which cleaves after the lysine leaving no residual amino acids. false false _1855_ 0 25686 9 Not in stock false Optimized for use in E. coli. false Alex Torgesen annotation2431526 1 enterokinase recognition site range2431526 1 1 15 BBa_K208010 1 BBa_K208010 Lac Promoter (BBa_R0010) and RBS (B0034) 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z synthetic Released HQ 2013 lac + rbs false false _310_ 0 3473 9 In stock true none false Elisabeth Linton annotation2034625 1 BBa_B0034 range2034625 1 209 220 annotation2034626 1 BBa_R0010 range2034626 1 1 200 BBa_K1162009 1 BBa_K1162009 10x-Histidine (10x-His) Tag with Met (ATG) For N-terminal purification 2013-09-14T11:00:00Z 2015-05-08T01:09:32Z E. coli This part uses assembly standard 23 (RFC 23-silver fusion) to allow for protein fusions. This 10x His Tag is similar to BBa_K844000 but has the double stop codon (TAA TAA) removed unlike BBa_K844000. (http://parts.igem.org/wiki/index.php?title=Part:BBa_K844000). Another characteristic of this part is the presence of a Met (ATG) for direct His Tag and protein expression. Since the presence of the Met (ATG) this His Tag should be used for protein purification at the N-terminal. The user can place a promoter-rbs system of their choice in front of this His Tag for direct expression. The lack of any stop codon in this His Tag allows the user to add additional features downstream of the gene e.g. secretion tag or GFP (note, the gene itself must not contain any stop codons if the His Tag is to be used like this). Related parts BBa_K844000 (http://parts.igem.org/wiki/index.php?title=Part:BBa_K844000), this link also provides an extensive review of existing Histidine Tags in the Parts Registry. false false _1474_ 0 9404 9 It's complicated true RFC 23 and contains an atg (met). No stop codon. false Kathleen Miller annotation2343739 1 start range2343739 1 1 3 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_M45711_sequence 1 gcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactg BBa_K1162009_sequence 1 atgcatcatcaccatcaccaccatcatcaccat BBa_M45750_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgcatcatcaccatcaccaccatcatcaccattactagaggatgatgatgataaatactagaggcctgcctcggtttcggtaaatcatgtaacccgagtaatgaccaatgctgcaaatcatcttcattagcttgttcaacaaaacataagtggtgcaaatacgaactgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K208010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_M45751_sequence 1 gatgatgatgataaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z